Review



plko 1 shrictor plasmids  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc plko 1 shrictor plasmids
    Plko 1 Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1267 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/pLKO%2E1+(Plasmid+%238407)/10__1016_slash_j__fbio__2025__106806-72-14-32
    Average 96 stars, based on 1267 article reviews
    plko 1 shrictor plasmids - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: α-Synuclein Activates the PI3K/AKT Pathway to Drive Lipid Droplets Accumulation: Implications for Parkinson’s Disease
    Article Snippet: Costume-ready Mission shSNCA were from Sigma-Aldrich (TRCN0000272292), shRictor, (Addgene #1853, donated by David Sabatini); shRaptor (Addgene #1857, donated by David Sabatini).

    Construct:

    Article Title: MITF -MIR211 axis is a novel autophagy amplifier system during cellular stress
    Article Snippet: .. D.G. is a recipient of an EMBO Strategical Development and Installation Grant (EMBO-SDIG), Turkish Academy of Sciences (TUBA) GEBIP Award, IKU Prof. Dr. Onder Oztunali Science Award, TGC Sedat Simavi Health Sciences Award and Elginkan Foundation Technology Award. shRICTOR (Addgene, 1853) and MYC-RICTOR (Addgene, 11367) plasmids were kindly provided by David Sabatini. pEGFP-N1-TFEB (Addgene, 38119), pEGFP-N1-MITF-A (Addgene, 38132) constructs were kindly provided by Shawn Ferguson. .. RFP-LAMP1 (Addgene, 1817) was kindly provided by Walther Mothes.



    Similar Products

    86
    Genechem lentiviral particles expressing shrna against rictor shrictor
    Lentiviral Particles Expressing Shrna Against Rictor Shrictor, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/constructs+lentiviral/pm41506005-63-27-41
    Average 86 stars, based on 1 article reviews
    lentiviral particles expressing shrna against rictor shrictor - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 shrictor plasmids
    Plko 1 Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/pLKO%2E1+(Plasmid+%238407)/10__1016_slash_j__fbio__2025__106806-72-14-32
    Average 96 stars, based on 1 article reviews
    plko 1 shrictor plasmids - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc shrictor
    Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/Rictor_1+shRNA+(Plasmid+%231853)/bio_rxiv__2025__03__27__645689-213-7-8
    Average 93 stars, based on 1 article reviews
    shrictor - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc plko shrictor #1853
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Plko Shrictor #1853, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/plko+shrictor++1853/pmc10740258-399-87-108
    Average 90 stars, based on 1 article reviews
    plko shrictor #1853 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc plko 1 shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/Rictor_2+shRNA+(Plasmid+%231854)/pmc09379402-79-3-31
    Average 93 stars, based on 1 article reviews
    plko 1 shrictor - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral plko 1 shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Lentiviral Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/Rictor_2+shRNA+(Plasmid+%231854)/pmc07352937-204-0-16
    Average 93 stars, based on 1 article reviews
    lentiviral plko 1 shrictor - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc shrictor plasmids
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/pLKO+mouse+shRNA+1+rictor+(Plasmid+%2321341)/pm29460266-58-8-11
    Average 90 stars, based on 1 article reviews
    shrictor plasmids - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Transomic Technologies Inc pzip-mcmv-zsgreen-shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Pzip Mcmv Zsgreen Shrictor, supplied by Transomic Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/pzip+mcmv+zsgreen+shrictor/pmc05736446-28-0-2
    Average 90 stars, based on 1 article reviews
    pzip-mcmv-zsgreen-shrictor - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Addgene inc shrna expression vectors against human rictor (shrictor 1 shrictor 2
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Shrna Expression Vectors Against Human Rictor (Shrictor 1 Shrictor 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrictor/lentiviral+vectors+containing+short+hairpin+rna++shrna++for+raptor++rictor++and+mtor/pmc04824156-59-29-46
    Average 90 stars, based on 1 article reviews
    shrna expression vectors against human rictor (shrictor 1 shrictor 2 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

    Journal: Cell & Bioscience

    Article Title: NUAK1 coordinates growth factor-dependent activation of mTORC2 and Akt signaling

    doi: 10.1186/s13578-023-01185-2

    Figure Lengend Snippet: Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

    Article Snippet: To generate pCW57 FLAG-hNUAK1 WT, hNUAK1 WT was amplified from pCMV FLAG-hNUAK1 and subcloned into pCW57-MCS1-2 A-MCS2 using NheI and AgeI restriction sites. pCMV FLAG-hNUAK1 K84A was generated by subcloning of FLAG-hNUAK1 K84A from pBABE FLAG-hNUAK1 K84A using EcoRI restriction sites. pBABE FLAG-hNUAK1 K84A was previously generated by site direct mutagenesis using the following primers: hNUAK1_K84A_F: GGCCGAGTGGTTGCTATAGCCTCCATTCGTAAGG, hNUAK1_K84A_R: CCTTACGAATGGAGGCTATAGCAACCACTCGGCC. pCMV FLAG-NUAK1 K84A mutation was confirmed by sequencing (Additional file : Fig. S6). pCW57-MCS1-2 A-MCS2 (#71782), FLAG FOXO3a (#8360), pCMV dR8.2 (#8360), pCMV VSVG (#8454), pLKO scramble (#1864), pLKO shRictor (#1853), Lamp1-YFP (#2532), Lamp1-RFP (#1817), EGFR-GFP (#32751), pRK5 Myc Rictor (#11367), pRK5 Myc Raptor (#1859), and mRFP-Rab5 (#14437) from Addgene. pCMV6 Myr-Akt1-HA was kindly provided by Dr. Philip Tsichlis, The Ohio State University, Rab7-GFP by Dr. Julio Tapia, Universidad de Chile, Chile, and pINDUCER10 shNUAK1 #1 and shNUAK1 #2 by Drs. Giacomo Cossa and Martin Eilers, University of Würzburg, Germany.

    Techniques: Inhibition, Phospho-proteomics